Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001189 | |||
Gene | MORC3 | Organism | Human |
Genome Locus | chr21:37711076-37717005:+ | Build | hg19 |
Disease | Hypopharyngeal Squamous Cell Carcinoma | ICD-10 | Malignant neoplasm of hypopharynx (C13) |
DBLink | Link to database | PMID | 28514762 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Tumor tissues and paired adjacent normal tissues were obtained from 36 patients |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GACACAGCTGGTTTCGAAGAG ReverseATGATCCTCGTCCCCTTCTT | Statistics | Fold Change : Downregulated,17.691 pvalue : p=0.006 |
Citation | |||
Cao, S, Wei, D, Li, X, Zhou, J, Li, W, Qian, Y, Wang, Z, Li, G, Pan, X, Lei, D (2017). Novel circular RNA expression profiles reflect progression of patients with hypopharyngeal squamous cell carcinoma. Oncotarget, 8, 28:45367-45379. |